ID: 1110313565

View in Genome Browser
Species Human (GRCh38)
Location 13:74079022-74079044
Sequence AGAATACCGTATATCAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110313565_1110313566 -9 Left 1110313565 13:74079022-74079044 CCAGACTTGATATACGGTATTCT 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1110313566 13:74079036-74079058 CGGTATTCTCTTCCCACAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110313565 Original CRISPR AGAATACCGTATATCAAGTC TGG (reversed) Intronic