ID: 1110313565

View in Genome Browser
Species Human (GRCh38)
Location 13:74079022-74079044
Sequence AGAATACCGTATATCAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110313565_1110313566 -9 Left 1110313565 13:74079022-74079044 CCAGACTTGATATACGGTATTCT 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1110313566 13:74079036-74079058 CGGTATTCTCTTCCCACAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110313565 Original CRISPR AGAATACCGTATATCAAGTC TGG (reversed) Intronic
907599540 1:55753249-55753271 AAAATACAGAATATCAAGACTGG - Intergenic
912238953 1:107884892-107884914 AGAATACAGTAACTAAAGTCAGG + Intronic
913605726 1:120463937-120463959 AGAATACAGTTTTTGAAGTCTGG - Intergenic
913643143 1:120831559-120831581 AGAATACAGTTTTTGAAGTCTGG - Intronic
913643910 1:120838312-120838334 AGAATACAGTTTTTGAAGTCTGG - Intronic
914082822 1:144425285-144425307 AGAATACAGTTTTTGAAGTCTGG + Intronic
914177738 1:145293789-145293811 AGAATACAGTTTTTGAAGTCTGG + Intronic
914178283 1:145298555-145298577 AGAATACAGTTTTTGAAGTCTGG + Intronic
914178828 1:145303301-145303323 AGAATACAGTTTTTGAAGTCTGG + Intronic
914179206 1:145306484-145306506 AGAATACAGTTTTTGAAGTCTGG + Intronic
914179581 1:145309665-145309687 AGAATACAGTTTTTGAAGTCTGG + Intronic
914180126 1:145314433-145314455 AGAATACAGTTTTTGAAGTCTGG + Intronic
914180671 1:145319203-145319225 AGAATACAGTTTTTGAAGTCTGG + Intronic
914181214 1:145323953-145323975 AGAATACAGTTTTTGAAGTCTGG + Intronic
914181757 1:145328713-145328735 AGAATACAGTTTTTGAAGTCTGG + Intronic
914182302 1:145333466-145333488 AGAATACAGTTTTTGAAGTCTGG + Intronic
914182847 1:145338222-145338244 AGAATACAGTTTTTGAAGTCTGG + Intronic
914183392 1:145342976-145342998 AGAATACAGTTTTTGAAGTCTGG + Intronic
914183936 1:145347746-145347768 AGAATACAGTTTTTGAAGTCTGG + Intronic
914184480 1:145352510-145352532 AGAATACAGTTTTTGAAGTCTGG + Intronic
914185024 1:145357258-145357280 AGAATACAGTTTTTGAAGTCTGG + Intronic
914185569 1:145362011-145362033 AGAATACAGTTTTTGAAGTCTGG + Intronic
914186115 1:145366771-145366793 AGAATACAGTTTTTGAAGTCTGG + Intronic
914186661 1:145371519-145371541 AGAATACAGTTTTTGAAGTCTGG + Intronic
914187205 1:145376273-145376295 AGAATACAGTTTTTGAAGTCTGG + Intronic
914187748 1:145381025-145381047 AGAATACAGTTTTTGAAGTCTGG + Intronic
914188293 1:145385781-145385803 AGAATACAGTTTTTGAAGTCTGG + Intronic
914188836 1:145390537-145390559 AGAATACAGTTTTTGAAGTCTGG + Intronic
914269988 1:146071736-146071758 AGAATACAGTTTTTGAAGTCTGG + Intronic
914270529 1:146076474-146076496 AGAATACAGTTTTTGAAGTCTGG + Intronic
914271065 1:146081204-146081226 AGAATACAGTTTTTGAAGTCTGG + Intronic
914272138 1:146090649-146090671 AGAATACAGTTTTTGAAGTCTGG + Intronic
914272674 1:146095371-146095393 AGAATACAGTTTTTGAAGTCTGG + Intronic
914273212 1:146100093-146100115 AGAATACAGTTTTTGAAGTCTGG + Intronic
914273751 1:146104811-146104833 AGAATACAGTTTTTGAAGTCTGG + Intronic
914274289 1:146109519-146109541 AGAATACAGTTTTTGAAGTCTGG + Intronic
914274825 1:146114237-146114259 AGAATACAGTTTTTGAAGTCTGG + Intronic
914275359 1:146118963-146118985 AGAATACAGTTTTTGAAGTCTGG + Intronic
914275894 1:146123695-146123717 AGAATACAGTTTTTGAAGTCTGG + Intronic
914366938 1:146987495-146987517 AGAATACAGTTTTTGAAGTCTGG - Intronic
914367474 1:146992256-146992278 AGAATACAGTTTTTGAAGTCTGG - Intronic
914485510 1:148105949-148105971 AGAATACAGTTTTTGAAGTCTGG + Intronic
914532827 1:148538417-148538439 AGAATACAGTTTTTGAAGTCTGG + Intronic
914533361 1:148543131-148543153 AGAATACAGTTTTTGAAGTCTGG + Intronic
914533896 1:148547839-148547861 AGAATACAGTTTTTGAAGTCTGG + Intronic
914534432 1:148552547-148552569 AGAATACAGTTTTTGAAGTCTGG + Intronic
914534968 1:148557259-148557281 AGAATACAGTTTTTGAAGTCTGG + Intronic
914535503 1:148562004-148562026 AGAATACAGTTTTTGAAGTCTGG + Intronic
914536039 1:148566720-148566742 AGAATACAGTGTTTGAAGTCTGG + Intronic
914536574 1:148571450-148571472 AGAATACAGTTTTTGAAGTCTGG + Intronic
914536935 1:148574646-148574668 AGAATACAGTTTTTGAAGTCTGG + Intronic
914585480 1:149057932-149057954 AGAATACAGTTTTTGAAGTCTGG + Intronic
914628988 1:149490704-149490726 AGAATACAGTTTTTGAAGTCTGG - Intergenic
914629521 1:149495461-149495483 AGAATACAGTTTTTGAAGTCTGG - Intergenic
914630056 1:149500216-149500238 AGAATACAGTTTTTGAAGTCTGG - Intergenic
914630590 1:149504977-149504999 AGAATACAGTTTTTGAAGTCTGG - Intergenic
914631123 1:149509738-149509760 AGAATACAGTTTTTGAAGTCTGG - Intergenic
914631655 1:149514499-149514521 AGAATACAGTTTTTGAAGTCTGG - Intergenic
914632191 1:149519253-149519275 AGAATACAGTTTTTGAAGTCTGG - Intergenic
914632728 1:149524008-149524030 AGAATACAGTTTTTGAAGTCTGG - Intergenic
914633262 1:149528757-149528779 AGAATACAGTTTTTGAAGTCTGG - Intergenic
914633798 1:149533488-149533510 AGAATACAGTTTTTGAAGTCTGG - Intergenic
914634334 1:149538243-149538265 AGAATACAGTTTTTGAAGTCTGG - Intergenic
914634868 1:149542996-149543018 AGAATACAGTTTTTGAAGTCTGG - Intergenic
914635403 1:149547733-149547755 AGAATACAGTTTTTGAAGTCTGG - Intergenic
914635938 1:149552470-149552492 AGAATACAGTTTTTGAAGTCTGG - Intergenic
1065503567 10:26406491-26406513 ATAATTCCGTATATCAATGCAGG - Intergenic
1069369771 10:67735233-67735255 ACATTAACATATATCAAGTCTGG + Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1078678657 11:13453052-13453074 ATAATACTGTGTATCATGTCAGG - Intronic
1083736971 11:64686994-64687016 AGAGAACCGGATATGAAGTCAGG + Intronic
1100910697 12:99358756-99358778 AGAATGCCCTATATGTAGTCAGG + Intronic
1110313565 13:74079022-74079044 AGAATACCGTATATCAAGTCTGG - Intronic
1112079095 13:95948375-95948397 AGAATAAGGTATTTCAATTCAGG - Intronic
1115972669 14:38963245-38963267 AGAATACAGGAGATGAAGTCAGG - Intergenic
1117569080 14:57028356-57028378 AGAATATTGTATATCAACTTTGG - Intergenic
1117864565 14:60132430-60132452 AAAATACCGTATATAAAGTAAGG - Intronic
1126059809 15:44769611-44769633 AGAATAACATATTTCAAGCCTGG - Intergenic
1142951488 17:3484865-3484887 AGAACACAGTGTATCAAGTATGG - Intronic
1151101762 17:71563864-71563886 AGAATATCTTATAACATGTCTGG + Intergenic
1152483777 17:80575288-80575310 AAAATACTGTATATCCAGCCAGG - Intronic
1157048893 18:44136711-44136733 TGAATACCAAATATCAAATCTGG - Intergenic
1164142456 19:22485062-22485084 AGAATGCCATATATCAAAACAGG - Intronic
1202676105 1_KI270711v1_random:8372-8394 AGAATACAGTTTTTGAAGTCTGG + Intergenic
929165162 2:38874702-38874724 AAAATACAGTATTTCAGGTCGGG - Intronic
940630077 2:156227411-156227433 AGAATACAGTATATCAAAACTGG + Intergenic
1174364880 20:50050605-50050627 TGAAGAACGTATATCAAGTCTGG - Intergenic
1174373352 20:50109272-50109294 AGAATACAAAATATGAAGTCAGG - Intronic
1177093728 21:16804208-16804230 AGAAGACCGAATATGAATTCAGG + Intergenic
1182439541 22:30354761-30354783 ATAATAACGTTTATCAAGTTGGG + Intronic
951075215 3:18383007-18383029 AGAATAGCTTTTATCAAGTTAGG + Intronic
963231140 3:142909936-142909958 AGAATAACATATAGAAAGTCAGG - Intergenic
964638780 3:158886070-158886092 AGAATGCAGCATATGAAGTCAGG + Intergenic
965323283 3:167272837-167272859 GGAAAACCGAATATCAAGGCTGG + Intronic
973160201 4:47006576-47006598 AAAATACTGTTTATCAAGTGGGG + Intronic
975148498 4:70995242-70995264 AGAAGACCATATATAAAGACAGG + Intronic
977169211 4:93739580-93739602 AAAGTACCTAATATCAAGTCAGG - Intronic
983079070 4:163363383-163363405 AAAATACCATTTATCTAGTCAGG - Intergenic
990790696 5:59475372-59475394 ATAATACCCTATTTCAAGTGGGG - Intronic
991233734 5:64368494-64368516 AGAACACAGGATATGAAGTCAGG - Intronic
991919505 5:71641564-71641586 AGAATTCAGTATATCACGTCAGG + Intronic
994432747 5:99689685-99689707 AAATTATTGTATATCAAGTCAGG - Intergenic
1003812667 6:9802497-9802519 AGAATACTGTATATCACGAGAGG - Intronic
1006206338 6:32346539-32346561 AAAATACTGTATCTCAAGCCTGG + Intronic
1006803642 6:36775011-36775033 AGAACACCCTAAATCCAGTCTGG - Exonic
1008972637 6:57387485-57387507 AGAAAACCTGAGATCAAGTCAGG - Intronic
1009161546 6:60289043-60289065 AGAAAACCTGAGATCAAGTCAGG - Intergenic
1023510480 7:40947567-40947589 ATAATACAGTATAGCAATTCTGG + Intergenic
1031852189 7:126878821-126878843 AGAAGACAGTATCTCAAGGCTGG - Intronic
1045490144 8:102661970-102661992 AAAATGCCATATTTCAAGTCTGG + Intergenic
1046046844 8:108974794-108974816 AGAAAACTGTCTATCAAGTGGGG + Intergenic
1052301708 9:26959402-26959424 AGAATAGCTTATATCCAGCCGGG - Intronic
1191633861 X:63354729-63354751 TGAATACAGTAGAGCAAGTCAGG + Intergenic