ID: 1110313566 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:74079036-74079058 |
Sequence | CGGTATTCTCTTCCCACAGT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 75 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 68} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1110313565_1110313566 | -9 | Left | 1110313565 | 13:74079022-74079044 | CCAGACTTGATATACGGTATTCT | 0: 1 1: 0 2: 0 3: 4 4: 108 |
||
Right | 1110313566 | 13:74079036-74079058 | CGGTATTCTCTTCCCACAGTAGG | 0: 1 1: 0 2: 0 3: 6 4: 68 |
||||
1110313564_1110313566 | -8 | Left | 1110313564 | 13:74079021-74079043 | CCCAGACTTGATATACGGTATTC | 0: 1 1: 0 2: 1 3: 1 4: 45 |
||
Right | 1110313566 | 13:74079036-74079058 | CGGTATTCTCTTCCCACAGTAGG | 0: 1 1: 0 2: 0 3: 6 4: 68 |
||||
1110313562_1110313566 | -1 | Left | 1110313562 | 13:74079014-74079036 | CCTGCATCCCAGACTTGATATAC | 0: 1 1: 0 2: 0 3: 6 4: 73 |
||
Right | 1110313566 | 13:74079036-74079058 | CGGTATTCTCTTCCCACAGTAGG | 0: 1 1: 0 2: 0 3: 6 4: 68 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1110313566 | Original CRISPR | CGGTATTCTCTTCCCACAGT AGG | Intronic | ||