ID: 1110313566

View in Genome Browser
Species Human (GRCh38)
Location 13:74079036-74079058
Sequence CGGTATTCTCTTCCCACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110313565_1110313566 -9 Left 1110313565 13:74079022-74079044 CCAGACTTGATATACGGTATTCT 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1110313566 13:74079036-74079058 CGGTATTCTCTTCCCACAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 68
1110313564_1110313566 -8 Left 1110313564 13:74079021-74079043 CCCAGACTTGATATACGGTATTC 0: 1
1: 0
2: 1
3: 1
4: 45
Right 1110313566 13:74079036-74079058 CGGTATTCTCTTCCCACAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 68
1110313562_1110313566 -1 Left 1110313562 13:74079014-74079036 CCTGCATCCCAGACTTGATATAC 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1110313566 13:74079036-74079058 CGGTATTCTCTTCCCACAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110313566 Original CRISPR CGGTATTCTCTTCCCACAGT AGG Intronic