ID: 1110324809

View in Genome Browser
Species Human (GRCh38)
Location 13:74201692-74201714
Sequence AGCCTGGATTTCCCAACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110324809_1110324812 -2 Left 1110324809 13:74201692-74201714 CCAGGAGTTGGGAAATCCAGGCT No data
Right 1110324812 13:74201713-74201735 CTTCTCTGGCTCCTCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110324809 Original CRISPR AGCCTGGATTTCCCAACTCC TGG (reversed) Intergenic
No off target data available for this crispr