ID: 1110326232

View in Genome Browser
Species Human (GRCh38)
Location 13:74218738-74218760
Sequence TCTAACATAATGATGTTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110326229_1110326232 5 Left 1110326229 13:74218710-74218732 CCATGGCCTAACCAAATGAGATA No data
Right 1110326232 13:74218738-74218760 TCTAACATAATGATGTTAGCTGG No data
1110326230_1110326232 -1 Left 1110326230 13:74218716-74218738 CCTAACCAAATGAGATAACGAGT No data
Right 1110326232 13:74218738-74218760 TCTAACATAATGATGTTAGCTGG No data
1110326231_1110326232 -6 Left 1110326231 13:74218721-74218743 CCAAATGAGATAACGAGTCTAAC No data
Right 1110326232 13:74218738-74218760 TCTAACATAATGATGTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110326232 Original CRISPR TCTAACATAATGATGTTAGC TGG Intergenic
No off target data available for this crispr