ID: 1110329418

View in Genome Browser
Species Human (GRCh38)
Location 13:74254090-74254112
Sequence ATGCATATAATTATGCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110329418_1110329421 28 Left 1110329418 13:74254090-74254112 CCTTCATGCATAATTATATGCAT No data
Right 1110329421 13:74254141-74254163 GTGTGTTTTTATTTACTGAGTGG No data
1110329418_1110329420 2 Left 1110329418 13:74254090-74254112 CCTTCATGCATAATTATATGCAT No data
Right 1110329420 13:74254115-74254137 CATATATGTATATGTCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110329418 Original CRISPR ATGCATATAATTATGCATGA AGG (reversed) Intergenic
No off target data available for this crispr