ID: 1110330776

View in Genome Browser
Species Human (GRCh38)
Location 13:74270041-74270063
Sequence TCAGGAAATTAGTAGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110330776_1110330782 17 Left 1110330776 13:74270041-74270063 CCTGGTTCCTACTAATTTCCTGA No data
Right 1110330782 13:74270081-74270103 TGTATAACATAAAACTTGGTTGG No data
1110330776_1110330781 13 Left 1110330776 13:74270041-74270063 CCTGGTTCCTACTAATTTCCTGA No data
Right 1110330781 13:74270077-74270099 GTGTTGTATAACATAAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110330776 Original CRISPR TCAGGAAATTAGTAGGAACC AGG (reversed) Intergenic
No off target data available for this crispr