ID: 1110330778

View in Genome Browser
Species Human (GRCh38)
Location 13:74270048-74270070
Sequence ACCAGGCTCAGGAAATTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110330778_1110330783 30 Left 1110330778 13:74270048-74270070 CCTACTAATTTCCTGAGCCTGGT No data
Right 1110330783 13:74270101-74270123 TGGCCTTTGTCCTGCTTACTAGG No data
1110330778_1110330782 10 Left 1110330778 13:74270048-74270070 CCTACTAATTTCCTGAGCCTGGT No data
Right 1110330782 13:74270081-74270103 TGTATAACATAAAACTTGGTTGG No data
1110330778_1110330781 6 Left 1110330778 13:74270048-74270070 CCTACTAATTTCCTGAGCCTGGT No data
Right 1110330781 13:74270077-74270099 GTGTTGTATAACATAAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110330778 Original CRISPR ACCAGGCTCAGGAAATTAGT AGG (reversed) Intergenic
No off target data available for this crispr