ID: 1110330780

View in Genome Browser
Species Human (GRCh38)
Location 13:74270065-74270087
Sequence TTATACAACACTGAAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110330780_1110330782 -7 Left 1110330780 13:74270065-74270087 CCTGGTTCTTCAGTGTTGTATAA No data
Right 1110330782 13:74270081-74270103 TGTATAACATAAAACTTGGTTGG No data
1110330780_1110330787 16 Left 1110330780 13:74270065-74270087 CCTGGTTCTTCAGTGTTGTATAA No data
Right 1110330787 13:74270104-74270126 CCTTTGTCCTGCTTACTAGGGGG No data
1110330780_1110330784 14 Left 1110330780 13:74270065-74270087 CCTGGTTCTTCAGTGTTGTATAA No data
Right 1110330784 13:74270102-74270124 GGCCTTTGTCCTGCTTACTAGGG No data
1110330780_1110330783 13 Left 1110330780 13:74270065-74270087 CCTGGTTCTTCAGTGTTGTATAA No data
Right 1110330783 13:74270101-74270123 TGGCCTTTGTCCTGCTTACTAGG No data
1110330780_1110330785 15 Left 1110330780 13:74270065-74270087 CCTGGTTCTTCAGTGTTGTATAA No data
Right 1110330785 13:74270103-74270125 GCCTTTGTCCTGCTTACTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110330780 Original CRISPR TTATACAACACTGAAGAACC AGG (reversed) Intergenic
No off target data available for this crispr