ID: 1110330782

View in Genome Browser
Species Human (GRCh38)
Location 13:74270081-74270103
Sequence TGTATAACATAAAACTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110330778_1110330782 10 Left 1110330778 13:74270048-74270070 CCTACTAATTTCCTGAGCCTGGT No data
Right 1110330782 13:74270081-74270103 TGTATAACATAAAACTTGGTTGG No data
1110330779_1110330782 -1 Left 1110330779 13:74270059-74270081 CCTGAGCCTGGTTCTTCAGTGTT No data
Right 1110330782 13:74270081-74270103 TGTATAACATAAAACTTGGTTGG No data
1110330780_1110330782 -7 Left 1110330780 13:74270065-74270087 CCTGGTTCTTCAGTGTTGTATAA No data
Right 1110330782 13:74270081-74270103 TGTATAACATAAAACTTGGTTGG No data
1110330776_1110330782 17 Left 1110330776 13:74270041-74270063 CCTGGTTCCTACTAATTTCCTGA No data
Right 1110330782 13:74270081-74270103 TGTATAACATAAAACTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110330782 Original CRISPR TGTATAACATAAAACTTGGT TGG Intergenic
No off target data available for this crispr