ID: 1110330785

View in Genome Browser
Species Human (GRCh38)
Location 13:74270103-74270125
Sequence GCCTTTGTCCTGCTTACTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110330780_1110330785 15 Left 1110330780 13:74270065-74270087 CCTGGTTCTTCAGTGTTGTATAA No data
Right 1110330785 13:74270103-74270125 GCCTTTGTCCTGCTTACTAGGGG No data
1110330779_1110330785 21 Left 1110330779 13:74270059-74270081 CCTGAGCCTGGTTCTTCAGTGTT No data
Right 1110330785 13:74270103-74270125 GCCTTTGTCCTGCTTACTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110330785 Original CRISPR GCCTTTGTCCTGCTTACTAG GGG Intergenic
No off target data available for this crispr