ID: 1110331609

View in Genome Browser
Species Human (GRCh38)
Location 13:74279191-74279213
Sequence ACTGGGATATTAAACCATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110331600_1110331609 21 Left 1110331600 13:74279147-74279169 CCTGTGCTTAAAATCCCCTGGGG No data
Right 1110331609 13:74279191-74279213 ACTGGGATATTAAACCATAATGG No data
1110331605_1110331609 5 Left 1110331605 13:74279163-74279185 CCTGGGGGAGAGTCTCTTCCATC No data
Right 1110331609 13:74279191-74279213 ACTGGGATATTAAACCATAATGG No data
1110331603_1110331609 7 Left 1110331603 13:74279161-74279183 CCCCTGGGGGAGAGTCTCTTCCA No data
Right 1110331609 13:74279191-74279213 ACTGGGATATTAAACCATAATGG No data
1110331604_1110331609 6 Left 1110331604 13:74279162-74279184 CCCTGGGGGAGAGTCTCTTCCAT No data
Right 1110331609 13:74279191-74279213 ACTGGGATATTAAACCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110331609 Original CRISPR ACTGGGATATTAAACCATAA TGG Intergenic
No off target data available for this crispr