ID: 1110331797

View in Genome Browser
Species Human (GRCh38)
Location 13:74281406-74281428
Sequence GTGTGATAAGTGTGGATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110331794_1110331797 24 Left 1110331794 13:74281359-74281381 CCTTGAGGAGATAAGAATTAAGA No data
Right 1110331797 13:74281406-74281428 GTGTGATAAGTGTGGATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110331797 Original CRISPR GTGTGATAAGTGTGGATGCA AGG Intergenic
No off target data available for this crispr