ID: 1110339266

View in Genome Browser
Species Human (GRCh38)
Location 13:74370108-74370130
Sequence TGCCTACCCTCACTGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110339266_1110339277 16 Left 1110339266 13:74370108-74370130 CCCTCACCCAGTGAGGGTAGGCA No data
Right 1110339277 13:74370147-74370169 GGCCCAGATAGGACTAAAGGAGG No data
1110339266_1110339280 21 Left 1110339266 13:74370108-74370130 CCCTCACCCAGTGAGGGTAGGCA No data
Right 1110339280 13:74370152-74370174 AGATAGGACTAAAGGAGGAAAGG No data
1110339266_1110339274 5 Left 1110339266 13:74370108-74370130 CCCTCACCCAGTGAGGGTAGGCA No data
Right 1110339274 13:74370136-74370158 CCATTGCCTAAGGCCCAGATAGG No data
1110339266_1110339276 13 Left 1110339266 13:74370108-74370130 CCCTCACCCAGTGAGGGTAGGCA No data
Right 1110339276 13:74370144-74370166 TAAGGCCCAGATAGGACTAAAGG No data
1110339266_1110339270 -5 Left 1110339266 13:74370108-74370130 CCCTCACCCAGTGAGGGTAGGCA No data
Right 1110339270 13:74370126-74370148 AGGCACCATCCCATTGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110339266 Original CRISPR TGCCTACCCTCACTGGGTGA GGG (reversed) Intergenic
No off target data available for this crispr