ID: 1110339270

View in Genome Browser
Species Human (GRCh38)
Location 13:74370126-74370148
Sequence AGGCACCATCCCATTGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110339266_1110339270 -5 Left 1110339266 13:74370108-74370130 CCCTCACCCAGTGAGGGTAGGCA No data
Right 1110339270 13:74370126-74370148 AGGCACCATCCCATTGCCTAAGG No data
1110339267_1110339270 -6 Left 1110339267 13:74370109-74370131 CCTCACCCAGTGAGGGTAGGCAC No data
Right 1110339270 13:74370126-74370148 AGGCACCATCCCATTGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110339270 Original CRISPR AGGCACCATCCCATTGCCTA AGG Intergenic
No off target data available for this crispr