ID: 1110339271

View in Genome Browser
Species Human (GRCh38)
Location 13:74370131-74370153
Sequence CTGGGCCTTAGGCAATGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110339271_1110339277 -7 Left 1110339271 13:74370131-74370153 CCATCCCATTGCCTAAGGCCCAG No data
Right 1110339277 13:74370147-74370169 GGCCCAGATAGGACTAAAGGAGG No data
1110339271_1110339280 -2 Left 1110339271 13:74370131-74370153 CCATCCCATTGCCTAAGGCCCAG No data
Right 1110339280 13:74370152-74370174 AGATAGGACTAAAGGAGGAAAGG No data
1110339271_1110339276 -10 Left 1110339271 13:74370131-74370153 CCATCCCATTGCCTAAGGCCCAG No data
Right 1110339276 13:74370144-74370166 TAAGGCCCAGATAGGACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110339271 Original CRISPR CTGGGCCTTAGGCAATGGGA TGG (reversed) Intergenic
No off target data available for this crispr