ID: 1110339273

View in Genome Browser
Species Human (GRCh38)
Location 13:74370136-74370158
Sequence CCTATCTGGGCCTTAGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110339273_1110339280 -7 Left 1110339273 13:74370136-74370158 CCATTGCCTAAGGCCCAGATAGG No data
Right 1110339280 13:74370152-74370174 AGATAGGACTAAAGGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110339273 Original CRISPR CCTATCTGGGCCTTAGGCAA TGG (reversed) Intergenic
No off target data available for this crispr