ID: 1110339274

View in Genome Browser
Species Human (GRCh38)
Location 13:74370136-74370158
Sequence CCATTGCCTAAGGCCCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110339266_1110339274 5 Left 1110339266 13:74370108-74370130 CCCTCACCCAGTGAGGGTAGGCA No data
Right 1110339274 13:74370136-74370158 CCATTGCCTAAGGCCCAGATAGG No data
1110339268_1110339274 -1 Left 1110339268 13:74370114-74370136 CCCAGTGAGGGTAGGCACCATCC No data
Right 1110339274 13:74370136-74370158 CCATTGCCTAAGGCCCAGATAGG No data
1110339267_1110339274 4 Left 1110339267 13:74370109-74370131 CCTCACCCAGTGAGGGTAGGCAC No data
Right 1110339274 13:74370136-74370158 CCATTGCCTAAGGCCCAGATAGG No data
1110339269_1110339274 -2 Left 1110339269 13:74370115-74370137 CCAGTGAGGGTAGGCACCATCCC No data
Right 1110339274 13:74370136-74370158 CCATTGCCTAAGGCCCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110339274 Original CRISPR CCATTGCCTAAGGCCCAGAT AGG Intergenic
No off target data available for this crispr