ID: 1110339277

View in Genome Browser
Species Human (GRCh38)
Location 13:74370147-74370169
Sequence GGCCCAGATAGGACTAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110339271_1110339277 -7 Left 1110339271 13:74370131-74370153 CCATCCCATTGCCTAAGGCCCAG No data
Right 1110339277 13:74370147-74370169 GGCCCAGATAGGACTAAAGGAGG No data
1110339269_1110339277 9 Left 1110339269 13:74370115-74370137 CCAGTGAGGGTAGGCACCATCCC No data
Right 1110339277 13:74370147-74370169 GGCCCAGATAGGACTAAAGGAGG No data
1110339267_1110339277 15 Left 1110339267 13:74370109-74370131 CCTCACCCAGTGAGGGTAGGCAC No data
Right 1110339277 13:74370147-74370169 GGCCCAGATAGGACTAAAGGAGG No data
1110339268_1110339277 10 Left 1110339268 13:74370114-74370136 CCCAGTGAGGGTAGGCACCATCC No data
Right 1110339277 13:74370147-74370169 GGCCCAGATAGGACTAAAGGAGG No data
1110339266_1110339277 16 Left 1110339266 13:74370108-74370130 CCCTCACCCAGTGAGGGTAGGCA No data
Right 1110339277 13:74370147-74370169 GGCCCAGATAGGACTAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110339277 Original CRISPR GGCCCAGATAGGACTAAAGG AGG Intergenic
No off target data available for this crispr