ID: 1110341554

View in Genome Browser
Species Human (GRCh38)
Location 13:74397690-74397712
Sequence CGCTTTTGCCCAAGAGACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110341554_1110341558 9 Left 1110341554 13:74397690-74397712 CCTCAGTCTCTTGGGCAAAAGCG No data
Right 1110341558 13:74397722-74397744 CCTCAGCCTCCAGAGTAGCTAGG 0: 8830
1: 210664
2: 276078
3: 178229
4: 93444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110341554 Original CRISPR CGCTTTTGCCCAAGAGACTG AGG (reversed) Intergenic
No off target data available for this crispr