ID: 1110346595

View in Genome Browser
Species Human (GRCh38)
Location 13:74455039-74455061
Sequence ACTAATAAGCAGTTATAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110346585_1110346595 15 Left 1110346585 13:74455001-74455023 CCAAAGAATCCCCTCTCCCCCCA No data
Right 1110346595 13:74455039-74455061 ACTAATAAGCAGTTATAGCAAGG No data
1110346592_1110346595 -4 Left 1110346592 13:74455020-74455042 CCCAAAAAAAACTACCAAAACTA No data
Right 1110346595 13:74455039-74455061 ACTAATAAGCAGTTATAGCAAGG No data
1110346589_1110346595 -1 Left 1110346589 13:74455017-74455039 CCCCCCAAAAAAAACTACCAAAA No data
Right 1110346595 13:74455039-74455061 ACTAATAAGCAGTTATAGCAAGG No data
1110346593_1110346595 -5 Left 1110346593 13:74455021-74455043 CCAAAAAAAACTACCAAAACTAA No data
Right 1110346595 13:74455039-74455061 ACTAATAAGCAGTTATAGCAAGG No data
1110346591_1110346595 -3 Left 1110346591 13:74455019-74455041 CCCCAAAAAAAACTACCAAAACT No data
Right 1110346595 13:74455039-74455061 ACTAATAAGCAGTTATAGCAAGG No data
1110346584_1110346595 30 Left 1110346584 13:74454986-74455008 CCTAAGTAGAAAATGCCAAAGAA No data
Right 1110346595 13:74455039-74455061 ACTAATAAGCAGTTATAGCAAGG No data
1110346587_1110346595 5 Left 1110346587 13:74455011-74455033 CCCTCTCCCCCCAAAAAAAACTA No data
Right 1110346595 13:74455039-74455061 ACTAATAAGCAGTTATAGCAAGG No data
1110346588_1110346595 4 Left 1110346588 13:74455012-74455034 CCTCTCCCCCCAAAAAAAACTAC No data
Right 1110346595 13:74455039-74455061 ACTAATAAGCAGTTATAGCAAGG No data
1110346586_1110346595 6 Left 1110346586 13:74455010-74455032 CCCCTCTCCCCCCAAAAAAAACT No data
Right 1110346595 13:74455039-74455061 ACTAATAAGCAGTTATAGCAAGG No data
1110346590_1110346595 -2 Left 1110346590 13:74455018-74455040 CCCCCAAAAAAAACTACCAAAAC No data
Right 1110346595 13:74455039-74455061 ACTAATAAGCAGTTATAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110346595 Original CRISPR ACTAATAAGCAGTTATAGCA AGG Intergenic
No off target data available for this crispr