ID: 1110348512

View in Genome Browser
Species Human (GRCh38)
Location 13:74477841-74477863
Sequence TTAGCTACTTGGTAGTTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110348509_1110348512 25 Left 1110348509 13:74477793-74477815 CCAATCAAGAACTCATGGATAAC No data
Right 1110348512 13:74477841-74477863 TTAGCTACTTGGTAGTTGTTGGG No data
1110348508_1110348512 28 Left 1110348508 13:74477790-74477812 CCACCAATCAAGAACTCATGGAT No data
Right 1110348512 13:74477841-74477863 TTAGCTACTTGGTAGTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110348512 Original CRISPR TTAGCTACTTGGTAGTTGTT GGG Intergenic
No off target data available for this crispr