ID: 1110352768

View in Genome Browser
Species Human (GRCh38)
Location 13:74528944-74528966
Sequence ACTATTGCATTGCTGTGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110352764_1110352768 23 Left 1110352764 13:74528898-74528920 CCTTAGGCTAGCAGCATGGAAAT No data
Right 1110352768 13:74528944-74528966 ACTATTGCATTGCTGTGGTTGGG No data
1110352763_1110352768 24 Left 1110352763 13:74528897-74528919 CCCTTAGGCTAGCAGCATGGAAA No data
Right 1110352768 13:74528944-74528966 ACTATTGCATTGCTGTGGTTGGG No data
1110352765_1110352768 -2 Left 1110352765 13:74528923-74528945 CCTATTACATGCTAATGCAGTAC No data
Right 1110352768 13:74528944-74528966 ACTATTGCATTGCTGTGGTTGGG No data
1110352762_1110352768 25 Left 1110352762 13:74528896-74528918 CCCCTTAGGCTAGCAGCATGGAA No data
Right 1110352768 13:74528944-74528966 ACTATTGCATTGCTGTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110352768 Original CRISPR ACTATTGCATTGCTGTGGTT GGG Intergenic
No off target data available for this crispr