ID: 1110358848

View in Genome Browser
Species Human (GRCh38)
Location 13:74601623-74601645
Sequence GCCCCCAACAATATATTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110358848_1110358849 29 Left 1110358848 13:74601623-74601645 CCATACAATATATTGTTGGGGGC No data
Right 1110358849 13:74601675-74601697 CTACTATTCTCACGTCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110358848 Original CRISPR GCCCCCAACAATATATTGTA TGG (reversed) Intergenic
No off target data available for this crispr