ID: 1110359929

View in Genome Browser
Species Human (GRCh38)
Location 13:74613087-74613109
Sequence CTGGGTCTACAGTTGGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110359924_1110359929 -4 Left 1110359924 13:74613068-74613090 CCAATCTAATTTCCTCTAACTGG No data
Right 1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG No data
1110359923_1110359929 9 Left 1110359923 13:74613055-74613077 CCTTTCACAATGACCAATCTAAT No data
Right 1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110359929 Original CRISPR CTGGGTCTACAGTTGGTGCA CGG Intergenic
No off target data available for this crispr