ID: 1110361570

View in Genome Browser
Species Human (GRCh38)
Location 13:74631113-74631135
Sequence TGCCATGGCATTAGTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110361563_1110361570 -5 Left 1110361563 13:74631095-74631117 CCCTGAAGGCTCACATGGTGCCA No data
Right 1110361570 13:74631113-74631135 TGCCATGGCATTAGTGGGGAGGG No data
1110361558_1110361570 14 Left 1110361558 13:74631076-74631098 CCCTGGGAGCCATCTTAGTCCCT No data
Right 1110361570 13:74631113-74631135 TGCCATGGCATTAGTGGGGAGGG No data
1110361561_1110361570 5 Left 1110361561 13:74631085-74631107 CCATCTTAGTCCCTGAAGGCTCA No data
Right 1110361570 13:74631113-74631135 TGCCATGGCATTAGTGGGGAGGG No data
1110361564_1110361570 -6 Left 1110361564 13:74631096-74631118 CCTGAAGGCTCACATGGTGCCAT No data
Right 1110361570 13:74631113-74631135 TGCCATGGCATTAGTGGGGAGGG No data
1110361559_1110361570 13 Left 1110361559 13:74631077-74631099 CCTGGGAGCCATCTTAGTCCCTG No data
Right 1110361570 13:74631113-74631135 TGCCATGGCATTAGTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110361570 Original CRISPR TGCCATGGCATTAGTGGGGA GGG Intergenic
No off target data available for this crispr