ID: 1110362469

View in Genome Browser
Species Human (GRCh38)
Location 13:74642990-74643012
Sequence ACACATGCATATCCTCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110362465_1110362469 18 Left 1110362465 13:74642949-74642971 CCTAGTACGATACCATAGTGACT No data
Right 1110362469 13:74642990-74643012 ACACATGCATATCCTCTCCAAGG No data
1110362466_1110362469 6 Left 1110362466 13:74642961-74642983 CCATAGTGACTTTACTGCCATCC No data
Right 1110362469 13:74642990-74643012 ACACATGCATATCCTCTCCAAGG No data
1110362464_1110362469 30 Left 1110362464 13:74642937-74642959 CCAGCAAGTTCTCCTAGTACGAT No data
Right 1110362469 13:74642990-74643012 ACACATGCATATCCTCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110362469 Original CRISPR ACACATGCATATCCTCTCCA AGG Intergenic
No off target data available for this crispr