ID: 1110365628

View in Genome Browser
Species Human (GRCh38)
Location 13:74681860-74681882
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110365628_1110365637 28 Left 1110365628 13:74681860-74681882 CCATATTCCTCGGGCTCACATTG No data
Right 1110365637 13:74681911-74681933 GAGCTGTTATCTTCTGCAGGGGG No data
1110365628_1110365634 25 Left 1110365628 13:74681860-74681882 CCATATTCCTCGGGCTCACATTG No data
Right 1110365634 13:74681908-74681930 CCTGAGCTGTTATCTTCTGCAGG No data
1110365628_1110365636 27 Left 1110365628 13:74681860-74681882 CCATATTCCTCGGGCTCACATTG No data
Right 1110365636 13:74681910-74681932 TGAGCTGTTATCTTCTGCAGGGG No data
1110365628_1110365635 26 Left 1110365628 13:74681860-74681882 CCATATTCCTCGGGCTCACATTG No data
Right 1110365635 13:74681909-74681931 CTGAGCTGTTATCTTCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110365628 Original CRISPR CAATGTGAGCCCGAGGAATA TGG (reversed) Intergenic
No off target data available for this crispr