ID: 1110368473

View in Genome Browser
Species Human (GRCh38)
Location 13:74714632-74714654
Sequence ATGCTGTTATTCATGACTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110368473_1110368475 15 Left 1110368473 13:74714632-74714654 CCTAGAGTCATGAATAACAGCAT No data
Right 1110368475 13:74714670-74714692 GCACTCTTATGTTATGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110368473 Original CRISPR ATGCTGTTATTCATGACTCT AGG (reversed) Intergenic
No off target data available for this crispr