ID: 1110371552

View in Genome Browser
Species Human (GRCh38)
Location 13:74746778-74746800
Sequence CTCTCTTAGCTTAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110371552_1110371555 1 Left 1110371552 13:74746778-74746800 CCATCCACCTTAAGCTAAGAGAG No data
Right 1110371555 13:74746802-74746824 TCTTCACGTTCTCTTGCAGTAGG No data
1110371552_1110371558 19 Left 1110371552 13:74746778-74746800 CCATCCACCTTAAGCTAAGAGAG No data
Right 1110371558 13:74746820-74746842 GTAGGACTTAGGGCCTCAGCAGG No data
1110371552_1110371557 9 Left 1110371552 13:74746778-74746800 CCATCCACCTTAAGCTAAGAGAG No data
Right 1110371557 13:74746810-74746832 TTCTCTTGCAGTAGGACTTAGGG No data
1110371552_1110371556 8 Left 1110371552 13:74746778-74746800 CCATCCACCTTAAGCTAAGAGAG No data
Right 1110371556 13:74746809-74746831 GTTCTCTTGCAGTAGGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110371552 Original CRISPR CTCTCTTAGCTTAAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr