ID: 1110371904

View in Genome Browser
Species Human (GRCh38)
Location 13:74750070-74750092
Sequence TAGGGTGTCTAATGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110371904_1110371912 -2 Left 1110371904 13:74750070-74750092 CCTTCCACCCATTAGACACCCTA No data
Right 1110371912 13:74750091-74750113 TAATAAGGAAAGGTGAAAAATGG No data
1110371904_1110371913 -1 Left 1110371904 13:74750070-74750092 CCTTCCACCCATTAGACACCCTA No data
Right 1110371913 13:74750092-74750114 AATAAGGAAAGGTGAAAAATGGG No data
1110371904_1110371915 29 Left 1110371904 13:74750070-74750092 CCTTCCACCCATTAGACACCCTA No data
Right 1110371915 13:74750122-74750144 ACAAACAGAGCAATAGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110371904 Original CRISPR TAGGGTGTCTAATGGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr