ID: 1110373340

View in Genome Browser
Species Human (GRCh38)
Location 13:74764225-74764247
Sequence CAAGAAGAACATCTTCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110373336_1110373340 30 Left 1110373336 13:74764172-74764194 CCACTATGTACTAAACGTAATGC No data
Right 1110373340 13:74764225-74764247 CAAGAAGAACATCTTCTGGTAGG No data
1110373338_1110373340 4 Left 1110373338 13:74764198-74764220 CCACACAGAAGACGGAGCTTTTG No data
Right 1110373340 13:74764225-74764247 CAAGAAGAACATCTTCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110373340 Original CRISPR CAAGAAGAACATCTTCTGGT AGG Intergenic
No off target data available for this crispr