ID: 1110375006

View in Genome Browser
Species Human (GRCh38)
Location 13:74783478-74783500
Sequence CAGGTATGAGCCGCCACGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110375006_1110375015 27 Left 1110375006 13:74783478-74783500 CCGAGCGTGGCGGCTCATACCTG No data
Right 1110375015 13:74783528-74783550 TGGAAGGATTGCATGAGCCCAGG 0: 9
1: 640
2: 8383
3: 27594
4: 61309
1110375006_1110375013 11 Left 1110375006 13:74783478-74783500 CCGAGCGTGGCGGCTCATACCTG No data
Right 1110375013 13:74783512-74783534 CTTTGAAAGGCCAAGGTGGAAGG 0: 6
1: 208
2: 3703
3: 32368
4: 89859
1110375006_1110375008 -2 Left 1110375006 13:74783478-74783500 CCGAGCGTGGCGGCTCATACCTG No data
Right 1110375008 13:74783499-74783521 TGTAATCCCAGCACTTTGAAAGG 0: 654
1: 22120
2: 317700
3: 261226
4: 143584
1110375006_1110375010 4 Left 1110375006 13:74783478-74783500 CCGAGCGTGGCGGCTCATACCTG No data
Right 1110375010 13:74783505-74783527 CCCAGCACTTTGAAAGGCCAAGG 0: 214
1: 6919
2: 96737
3: 216879
4: 233943
1110375006_1110375012 7 Left 1110375006 13:74783478-74783500 CCGAGCGTGGCGGCTCATACCTG No data
Right 1110375012 13:74783508-74783530 AGCACTTTGAAAGGCCAAGGTGG 0: 142
1: 4722
2: 67272
3: 155215
4: 158933

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110375006 Original CRISPR CAGGTATGAGCCGCCACGCT CGG (reversed) Intergenic
No off target data available for this crispr