ID: 1110375007

View in Genome Browser
Species Human (GRCh38)
Location 13:74783497-74783519
Sequence TTTCAAAGTGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 741548
Summary {0: 617, 1: 21704, 2: 314826, 3: 261129, 4: 143272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110375007_1110375015 8 Left 1110375007 13:74783497-74783519 CCTGTAATCCCAGCACTTTGAAA 0: 617
1: 21704
2: 314826
3: 261129
4: 143272
Right 1110375015 13:74783528-74783550 TGGAAGGATTGCATGAGCCCAGG 0: 9
1: 640
2: 8383
3: 27594
4: 61309
1110375007_1110375018 26 Left 1110375007 13:74783497-74783519 CCTGTAATCCCAGCACTTTGAAA 0: 617
1: 21704
2: 314826
3: 261129
4: 143272
Right 1110375018 13:74783546-74783568 CCAGGAGTTTGAGACCAGCCTGG 0: 18758
1: 81811
2: 152089
3: 186177
4: 177040
1110375007_1110375019 27 Left 1110375007 13:74783497-74783519 CCTGTAATCCCAGCACTTTGAAA 0: 617
1: 21704
2: 314826
3: 261129
4: 143272
Right 1110375019 13:74783547-74783569 CAGGAGTTTGAGACCAGCCTGGG 0: 19126
1: 38854
2: 56666
3: 50459
4: 31838
1110375007_1110375013 -8 Left 1110375007 13:74783497-74783519 CCTGTAATCCCAGCACTTTGAAA 0: 617
1: 21704
2: 314826
3: 261129
4: 143272
Right 1110375013 13:74783512-74783534 CTTTGAAAGGCCAAGGTGGAAGG 0: 6
1: 208
2: 3703
3: 32368
4: 89859

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110375007 Original CRISPR TTTCAAAGTGCTGGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr