ID: 1110375013

View in Genome Browser
Species Human (GRCh38)
Location 13:74783512-74783534
Sequence CTTTGAAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126144
Summary {0: 6, 1: 208, 2: 3703, 3: 32368, 4: 89859}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110375007_1110375013 -8 Left 1110375007 13:74783497-74783519 CCTGTAATCCCAGCACTTTGAAA 0: 617
1: 21704
2: 314826
3: 261129
4: 143272
Right 1110375013 13:74783512-74783534 CTTTGAAAGGCCAAGGTGGAAGG 0: 6
1: 208
2: 3703
3: 32368
4: 89859
1110375006_1110375013 11 Left 1110375006 13:74783478-74783500 CCGAGCGTGGCGGCTCATACCTG No data
Right 1110375013 13:74783512-74783534 CTTTGAAAGGCCAAGGTGGAAGG 0: 6
1: 208
2: 3703
3: 32368
4: 89859

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110375013 Original CRISPR CTTTGAAAGGCCAAGGTGGA AGG Intergenic
Too many off-targets to display for this crispr