ID: 1110377267

View in Genome Browser
Species Human (GRCh38)
Location 13:74807307-74807329
Sequence TTGGGCAATGACAGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110377267_1110377282 15 Left 1110377267 13:74807307-74807329 CCAGCCACCCTGTCATTGCCCAA No data
Right 1110377282 13:74807345-74807367 AGTGGCCATGGTGGCAGGGATGG 0: 184
1: 239
2: 223
3: 215
4: 751
1110377267_1110377283 18 Left 1110377267 13:74807307-74807329 CCAGCCACCCTGTCATTGCCCAA No data
Right 1110377283 13:74807348-74807370 GGCCATGGTGGCAGGGATGGAGG 0: 179
1: 213
2: 209
3: 260
4: 1022
1110377267_1110377285 28 Left 1110377267 13:74807307-74807329 CCAGCCACCCTGTCATTGCCCAA No data
Right 1110377285 13:74807358-74807380 GCAGGGATGGAGGTTATGCACGG 0: 90
1: 181
2: 230
3: 251
4: 427
1110377267_1110377276 3 Left 1110377267 13:74807307-74807329 CCAGCCACCCTGTCATTGCCCAA No data
Right 1110377276 13:74807333-74807355 GCCCATGAACAAAGTGGCCATGG 0: 144
1: 224
2: 189
3: 158
4: 280
1110377267_1110377279 6 Left 1110377267 13:74807307-74807329 CCAGCCACCCTGTCATTGCCCAA No data
Right 1110377279 13:74807336-74807358 CATGAACAAAGTGGCCATGGTGG 0: 195
1: 247
2: 189
3: 169
4: 334
1110377267_1110377275 -3 Left 1110377267 13:74807307-74807329 CCAGCCACCCTGTCATTGCCCAA No data
Right 1110377275 13:74807327-74807349 CAATGGGCCCATGAACAAAGTGG 0: 140
1: 205
2: 183
3: 167
4: 314
1110377267_1110377280 10 Left 1110377267 13:74807307-74807329 CCAGCCACCCTGTCATTGCCCAA No data
Right 1110377280 13:74807340-74807362 AACAAAGTGGCCATGGTGGCAGG 0: 190
1: 244
2: 192
3: 188
4: 1307
1110377267_1110377286 29 Left 1110377267 13:74807307-74807329 CCAGCCACCCTGTCATTGCCCAA No data
Right 1110377286 13:74807359-74807381 CAGGGATGGAGGTTATGCACGGG No data
1110377267_1110377281 11 Left 1110377267 13:74807307-74807329 CCAGCCACCCTGTCATTGCCCAA No data
Right 1110377281 13:74807341-74807363 ACAAAGTGGCCATGGTGGCAGGG 0: 176
1: 242
2: 200
3: 132
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110377267 Original CRISPR TTGGGCAATGACAGGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr