ID: 1110390162

View in Genome Browser
Species Human (GRCh38)
Location 13:74964231-74964253
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110390161_1110390162 -1 Left 1110390161 13:74964209-74964231 CCAAAGCAGCATGATACTGGTAC 0: 12
1: 638
2: 13650
3: 8088
4: 5542
Right 1110390162 13:74964231-74964253 CTAAAACATATATAGACCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110390162 Original CRISPR CTAAAACATATATAGACCAA TGG Intergenic
No off target data available for this crispr