ID: 1110392947

View in Genome Browser
Species Human (GRCh38)
Location 13:74996603-74996625
Sequence ACAATTTCAGAATCCTTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110392947_1110392951 4 Left 1110392947 13:74996603-74996625 CCAATGAAGGATTCTGAAATTGT No data
Right 1110392951 13:74996630-74996652 TCACCACGATGGTTGGTTGATGG No data
1110392947_1110392948 -7 Left 1110392947 13:74996603-74996625 CCAATGAAGGATTCTGAAATTGT No data
Right 1110392948 13:74996619-74996641 AAATTGTCCTATCACCACGATGG No data
1110392947_1110392949 -3 Left 1110392947 13:74996603-74996625 CCAATGAAGGATTCTGAAATTGT No data
Right 1110392949 13:74996623-74996645 TGTCCTATCACCACGATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110392947 Original CRISPR ACAATTTCAGAATCCTTCAT TGG (reversed) Intergenic