ID: 1110392951

View in Genome Browser
Species Human (GRCh38)
Location 13:74996630-74996652
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110392947_1110392951 4 Left 1110392947 13:74996603-74996625 CCAATGAAGGATTCTGAAATTGT No data
Right 1110392951 13:74996630-74996652 TCACCACGATGGTTGGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110392951 Original CRISPR TCACCACGATGGTTGGTTGA TGG Intergenic