ID: 1110397278

View in Genome Browser
Species Human (GRCh38)
Location 13:75045777-75045799
Sequence GCAAATCCTGTTACCAATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110397274_1110397278 -6 Left 1110397274 13:75045760-75045782 CCTATGGAAACCCTTTGGCAAAT No data
Right 1110397278 13:75045777-75045799 GCAAATCCTGTTACCAATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110397278 Original CRISPR GCAAATCCTGTTACCAATGG CGG Intergenic
No off target data available for this crispr