ID: 1110398527

View in Genome Browser
Species Human (GRCh38)
Location 13:75062625-75062647
Sequence GAGAAGAAGGAGGAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110398523_1110398527 -3 Left 1110398523 13:75062605-75062627 CCAAGCATGATAGAGAAAAAGAG No data
Right 1110398527 13:75062625-75062647 GAGAAGAAGGAGGAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110398527 Original CRISPR GAGAAGAAGGAGGAGAAGGA AGG Intergenic
No off target data available for this crispr