ID: 1110399944

View in Genome Browser
Species Human (GRCh38)
Location 13:75078496-75078518
Sequence CACAGATGGTAGAAGTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110399944_1110399950 11 Left 1110399944 13:75078496-75078518 CCCTCATACTTCTACCATCTGTG No data
Right 1110399950 13:75078530-75078552 CTCATGAAAATTTTCAGGCTAGG No data
1110399944_1110399951 19 Left 1110399944 13:75078496-75078518 CCCTCATACTTCTACCATCTGTG No data
Right 1110399951 13:75078538-75078560 AATTTTCAGGCTAGGCACAGTGG 0: 2
1: 11
2: 191
3: 1341
4: 6151
1110399944_1110399947 6 Left 1110399944 13:75078496-75078518 CCCTCATACTTCTACCATCTGTG No data
Right 1110399947 13:75078525-75078547 TCCTCCTCATGAAAATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110399944 Original CRISPR CACAGATGGTAGAAGTATGA GGG (reversed) Intergenic
No off target data available for this crispr