ID: 1110401087

View in Genome Browser
Species Human (GRCh38)
Location 13:75092917-75092939
Sequence TCCCAAAGTGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110401087_1110401099 24 Left 1110401087 13:75092917-75092939 CCTGTAATCCCAGCACTTTGGGA No data
Right 1110401099 13:75092964-75092986 TCAGGGGTTCGAGACCAACCTGG No data
1110401087_1110401095 1 Left 1110401087 13:75092917-75092939 CCTGTAATCCCAGCACTTTGGGA No data
Right 1110401095 13:75092941-75092963 GCTGATGGGGGCAGATCAAGAGG No data
1110401087_1110401098 8 Left 1110401087 13:75092917-75092939 CCTGTAATCCCAGCACTTTGGGA No data
Right 1110401098 13:75092948-75092970 GGGGCAGATCAAGAGGTCAGGGG No data
1110401087_1110401096 6 Left 1110401087 13:75092917-75092939 CCTGTAATCCCAGCACTTTGGGA No data
Right 1110401096 13:75092946-75092968 TGGGGGCAGATCAAGAGGTCAGG No data
1110401087_1110401097 7 Left 1110401087 13:75092917-75092939 CCTGTAATCCCAGCACTTTGGGA No data
Right 1110401097 13:75092947-75092969 GGGGGCAGATCAAGAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110401087 Original CRISPR TCCCAAAGTGCTGGGATTAC AGG (reversed) Intergenic