ID: 1110401090

View in Genome Browser
Species Human (GRCh38)
Location 13:75092926-75092948
Sequence CCATCAGCCTCCCAAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110401090_1110401097 -2 Left 1110401090 13:75092926-75092948 CCAGCACTTTGGGAGGCTGATGG No data
Right 1110401097 13:75092947-75092969 GGGGGCAGATCAAGAGGTCAGGG No data
1110401090_1110401096 -3 Left 1110401090 13:75092926-75092948 CCAGCACTTTGGGAGGCTGATGG No data
Right 1110401096 13:75092946-75092968 TGGGGGCAGATCAAGAGGTCAGG No data
1110401090_1110401095 -8 Left 1110401090 13:75092926-75092948 CCAGCACTTTGGGAGGCTGATGG No data
Right 1110401095 13:75092941-75092963 GCTGATGGGGGCAGATCAAGAGG No data
1110401090_1110401098 -1 Left 1110401090 13:75092926-75092948 CCAGCACTTTGGGAGGCTGATGG No data
Right 1110401098 13:75092948-75092970 GGGGCAGATCAAGAGGTCAGGGG No data
1110401090_1110401099 15 Left 1110401090 13:75092926-75092948 CCAGCACTTTGGGAGGCTGATGG No data
Right 1110401099 13:75092964-75092986 TCAGGGGTTCGAGACCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110401090 Original CRISPR CCATCAGCCTCCCAAAGTGC TGG (reversed) Intergenic