ID: 1110401099

View in Genome Browser
Species Human (GRCh38)
Location 13:75092964-75092986
Sequence TCAGGGGTTCGAGACCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110401090_1110401099 15 Left 1110401090 13:75092926-75092948 CCAGCACTTTGGGAGGCTGATGG No data
Right 1110401099 13:75092964-75092986 TCAGGGGTTCGAGACCAACCTGG No data
1110401089_1110401099 16 Left 1110401089 13:75092925-75092947 CCCAGCACTTTGGGAGGCTGATG No data
Right 1110401099 13:75092964-75092986 TCAGGGGTTCGAGACCAACCTGG No data
1110401087_1110401099 24 Left 1110401087 13:75092917-75092939 CCTGTAATCCCAGCACTTTGGGA No data
Right 1110401099 13:75092964-75092986 TCAGGGGTTCGAGACCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110401099 Original CRISPR TCAGGGGTTCGAGACCAACC TGG Intergenic