ID: 1110405884

View in Genome Browser
Species Human (GRCh38)
Location 13:75150071-75150093
Sequence GTCAATTGTAGGTCTGGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110405884_1110405888 29 Left 1110405884 13:75150071-75150093 CCCTAGCCAGACCTACAATTGAC No data
Right 1110405888 13:75150123-75150145 TAGAACACTGCTATCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110405884 Original CRISPR GTCAATTGTAGGTCTGGCTA GGG (reversed) Intergenic
No off target data available for this crispr