ID: 1110407598

View in Genome Browser
Species Human (GRCh38)
Location 13:75168226-75168248
Sequence AGAGAAAAGCAGAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110407594_1110407598 29 Left 1110407594 13:75168174-75168196 CCTTAGGGACTGCCATTTTGTTA No data
Right 1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG No data
1110407595_1110407598 17 Left 1110407595 13:75168186-75168208 CCATTTTGTTAAAGCATTCTGTC No data
Right 1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110407598 Original CRISPR AGAGAAAAGCAGAATGAGGC AGG Intergenic
No off target data available for this crispr