ID: 1110411032

View in Genome Browser
Species Human (GRCh38)
Location 13:75204172-75204194
Sequence TGAGAACACCACCAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110411028_1110411032 18 Left 1110411028 13:75204131-75204153 CCTACTTTTAAATAACTGGATCT No data
Right 1110411032 13:75204172-75204194 TGAGAACACCACCAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110411032 Original CRISPR TGAGAACACCACCAAGGGGA TGG Intergenic
No off target data available for this crispr