ID: 1110411105

View in Genome Browser
Species Human (GRCh38)
Location 13:75204678-75204700
Sequence CTCAGGGGTGGAGCTACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110411105_1110411111 1 Left 1110411105 13:75204678-75204700 CCTTGGGTAGCTCCACCCCTGAG No data
Right 1110411111 13:75204702-75204724 CTTTGCAGCATTCAGCCCTCAGG No data
1110411105_1110411113 14 Left 1110411105 13:75204678-75204700 CCTTGGGTAGCTCCACCCCTGAG No data
Right 1110411113 13:75204715-75204737 AGCCCTCAGGCTGCTCTCAAGGG No data
1110411105_1110411112 13 Left 1110411105 13:75204678-75204700 CCTTGGGTAGCTCCACCCCTGAG No data
Right 1110411112 13:75204714-75204736 CAGCCCTCAGGCTGCTCTCAAGG No data
1110411105_1110411117 28 Left 1110411105 13:75204678-75204700 CCTTGGGTAGCTCCACCCCTGAG No data
Right 1110411117 13:75204729-75204751 TCTCAAGGGCTGGCACTGAGTGG No data
1110411105_1110411116 18 Left 1110411105 13:75204678-75204700 CCTTGGGTAGCTCCACCCCTGAG No data
Right 1110411116 13:75204719-75204741 CTCAGGCTGCTCTCAAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110411105 Original CRISPR CTCAGGGGTGGAGCTACCCA AGG (reversed) Intergenic
No off target data available for this crispr