ID: 1110414626

View in Genome Browser
Species Human (GRCh38)
Location 13:75238394-75238416
Sequence CCTTCTTTGGATAAAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110414626_1110414631 10 Left 1110414626 13:75238394-75238416 CCATCCATTTTATCCAAAGAAGG No data
Right 1110414631 13:75238427-75238449 CTTCTGAGTTCTGATGGTCCAGG 0: 1
1: 1
2: 0
3: 14
4: 159
1110414626_1110414630 4 Left 1110414626 13:75238394-75238416 CCATCCATTTTATCCAAAGAAGG No data
Right 1110414630 13:75238421-75238443 TTAAAACTTCTGAGTTCTGATGG 0: 1
1: 7
2: 6
3: 26
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110414626 Original CRISPR CCTTCTTTGGATAAAATGGA TGG (reversed) Intergenic
No off target data available for this crispr