ID: 1110416004

View in Genome Browser
Species Human (GRCh38)
Location 13:75253453-75253475
Sequence GTCTCTCGGTAGCAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110416000_1110416004 -10 Left 1110416000 13:75253440-75253462 CCAAGAGTGTGCTGTCTCTCGGT No data
Right 1110416004 13:75253453-75253475 GTCTCTCGGTAGCAGGGGACAGG No data
1110415998_1110416004 21 Left 1110415998 13:75253409-75253431 CCACTTTGTGATCTGCAGAGATC No data
Right 1110416004 13:75253453-75253475 GTCTCTCGGTAGCAGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110416004 Original CRISPR GTCTCTCGGTAGCAGGGGAC AGG Intergenic
No off target data available for this crispr